SAMTOOLS SAMFILE tags

SAM format summary

The Sequence Alignment/Map (SAM) format is a generic alignment format for storing read alignments against reference sequences. It is a text format for storing sequence data in a series of tab delimited ASCII columns and is commonly used in next-generation sequencing data processing. It is the (non-binary) human-readable version of the BAM format and contains information about the read and the aligned position in the genome. It was developed by Heng Li in Richard Durbins group and others, their paper is here.

After a header section the alignment section describes all results of the aligned read data. The format is best explained with an example line:

Code

1:497:R:-272+13M17D24M  113  1  497  37  37M  15  100338662  0  CGGGTCTGACCTGAGGAGAACTGTGCTCCGCCTTCAG  0;==-==9;>>>>>=>>>>>>>>>>>=>>>>>>>>>>  XT:A:U  NM:i:0  SM:i:37  AM:i:0  X0:i:1  X1:i:0  XM:i:0  XO:i:0  XG:i:0  MD:Z:37

Fieldname description Example-data
QNAME read name 1:497:R:-272+13M17D24M
FLAG alignment flag 113
RNAME alignment chromosome 1
POS alignment start position 497
MAPQ overall mapping quality 37
CIGAR alignment CIGAR string 37M
MRNM/RNEXT name of next alignm. in group (mate) 15
MPOS/PNEXT pos. of next alignm. in group (mate) 100338662
ISIZE/TLEN observed Template LENgth 0
SEQ sequence CGGGTCTGACCTGAGGAGAACTGTGCTCCGCCTTCAG
QUAL quality per base 0;==-==9;>>>>>=>>>>>>>>>>>=>>>>>>>>>>
TAGs further tags with alignment info
XT:A:U NM:i:0 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:37

The tags are optional and might vary between alignment programs. Shown are examples from BWA. Important for filtering are usually the tags X0:i (numbers of genome alignments of this read) and XM:i (number of mismatches in alignment).

       Tag Meaning
       NM Edit distance
       MD Mismatching positions/bases
       AS Alignment score
       BC Barcode sequence
       X0 Number of best hits
       X1 Number of suboptimal hits found by BWA
       XN Number of ambiguous bases in the referenece
       XM Number of mismatches in the alignment
       XO Number of gap opens
       XG Number of gap extentions
       XT Type: Unique/Repeat/N/Mate-sw
       XA Alternative hits; format: (chr,pos,CIGAR,NM;)*
       XS Suboptimal alignment score
       XF Support from forward/reverse alignment
       XE Number of supporting seeds

The read name (at least from Illumina machines) are constructed as:

[instrument-name]:[run ID]:[flowcell ID]:[lane-number]:[tile-number]:
[x-pos]:[y-pos] [read number]:[is filtered]:[control number]:
[barcode sequence]

example:

@M01117:25:000000000-A37B9:1:1101:14984:1386 1:N:0:4

Sources:
genome.sph.umich.ed with further useful details, full specs.